WebJul 24, 2024 · Yokoi et al. (2003) concluded that LHPP, like bovine Lhpp, may function as a protein phosphatase that hydrolyzes phospholysine and/or phosphohistidine. Hindupur et al. (2024) demonstrated that LHPP is indeed a protein histidine phosphatase. Consistent with these observations, global histidine phosphorylation was significantly upregulated in ... WebPhospholysine phosphohistidine inorganic pyrophosphate phosphatase: Lhpp: CCCTGGGAAAAGGACGCTATT AATCATGATGGCCTGGTGGG: Mechanistic target of rapamycin kinase: Mtor: CACCCATCCAACCTGATGCT ATCGAGACCGGTAACCTCCA: Regulatory associated protein of MTOR, complex 1: Rptor: TGGGTCTTCAACAAGGTAGC …
1H, 13C, and 15N resonance assignments of human phosphohistidine …
WebJul 12, 2009 · A mammalian 14-kDa phosphohistidine phosphatase, also denominated PHPT1, was found 6 years ago that provided a new tool in the study of phosphohistidine phosphorylation. The localization of PHPT1 mRNA by Northern blot analysis revealed high expression in heart and skeletal muscle. The main object of the present study was to … WebNov 27, 2024 · The vast majority of protein phosphatases that have been identified target phosphoserine, phosphotheronine, and phosphotyrosine. A widely conserved … pine labs centralized download
Advances in development of new tools for the study of phosphohistidine …
WebJul 31, 2006 · The structure of phosphohistidine phosphatase (PHPT1), the first identified eukaryotic-protein histidine phosphatase, has been determined to a resolution of 1.9A … WebNov 23, 2024 · Here we identify the mechanism by which a bacterial phosphohistidine phosphatase dephosphorylates the nitrogen-related phosphotransferase system, a … WebMar 10, 2024 · Liver fibrosis, a major cause of morbidity and mortality worldwide, leads to liver damage, seriously threatening human health. In our previous study, we demonstrated that 14 kDa phosphohistidine phosphatase (PHP14) was upregulated in fibrotic liver tissue and involved in the migration and lamellipodia formation of hepatic stellate cells (HSCs). … pine labs net worth